Which formation is the result of wind erosion?

Answers

Answer 1

Answer:

Of the following given choices;

A. glacial erratics B. U-shaped valleys C. unusually shaped rocks D. mudslides.

The answer is; C.

The wind carries soil particles is it blows. These soil particle hit on rocks in their path and over time gradually erode the rocks. An example of this type of erosion is the aeolian process. Usually the bottom o the rock is eroded more than the top. This is because the bottom is hit by larger soil particles that are heavier to carry by the wind. An example of rock formed in this process is attached in the picture below.

Answer 2

Answer:

Answer:

the awnser is D

Explanation:

HOPE THIS HELPS! :)

Related Questions

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?
Which organ in the human body plays a dual role in both the digestive and respiratory systems? A) Liver. B) Lungs. C) Stomach. D) Pancreas.
2. What is a living organism? What are the main characteristics of organisms?
Most European nations have a dominant culture.a. Trueb. False
The growth of most plants is limited by the amount of nitrogen available. Which of the following effects does low nitrogen availability most likely have on the carbon cycle?A More carbon dioxide is taken up by plants B Carbon dioxide is trapped in the soil around plants C Less carbon dioxide is removed from the atmosphere. D Carbon dioxide is converted to carbonates by bacteria.

Which of the following statements about paper recycling is not true?a. Recycling one ton of newspaper can save 100 trees.
b. Recycling paper can lead to 74% less air pollution.
c. Paper recycling can save on the use of water resources.
d. Recycling paper can lead to 35% less water pollution.

Answers

The statement presented above that is not true about paper recycling is; A) Recycling one ton of newspaper can save 100 trees.

Paper recycling are the processes of reprocessing waste paper such as old newspapers and magazines into new paper products for reuse. Apart from saving trees from being cut, paper recycling has many other significant benefits such as reducing water and air pollution, saving on the use of water resources and energy. For every ton (200 pounds) of newspaper that is recycled, 17 trees are saved.

The false statement here is that; "recycling paper can lead to 35% less water pollution." The idea of recycling a huge environmental conservation effort.

What is recycling?

The term recycling has to do with the process of using a material for the same or another purpose rather than simply disposing the material after it has been used. The idea of recycling a huge environmental conservation effort.

The false statement here is that; "recycling paper can lead to 35% less water pollution."

Learn more about recycling- brainly.com/question/11861824?:

Chromatin is visible during this phase

Answers

It only visible during the interphase.

"On the Mode of Communication of Cholera" was a scientific text written by Dr. John Snow in 1855 about the disease cholera. Identify the two primary purposes of this text.A. to persuade officials and citizens to be more conscious about sanitation

B. to inform readers about new ideas about the disease using scientific evidence as support

C. to narrate the consequences of contracting the disease

D. to describe the lack of sanitation at the time of the story

Answers

"On the mode of communication of cholera" was written by Dr. John Snow in order to spread awareness about the disease and the new ideas giving scientific proof along with them. Through his text, he aimed at persuading the citizens and the officials to become more aware regarding the sanitation of their surroundings as Cholera is transmitted via the dirty surroundings. In his text he discussed the causes of spread, instances and scientific evidence of Cholera of its communication among different populations.

Hence, the correct answer is 'Option A and B'.

“On the Mode of Communication of Cholera” was a scientific text written by Dr. John Snow in 1855 about the disease cholera. The two primary purposes of this text were to persuade officials and citizens to be more conscious about sanitation, and to inform readers about new ideas about the disease using scientific evidence as support. The answer would be letters A and B.

In which ways are RNA and DNA different?a. RNA has ribose sugar, DNA has deoxyribose sugar
b. RNA has uracil, DNA has thymine
c. RNA is single-stranded, DNA is a double-helix
d. all of the above

Answers

Answer:

d. all of the above is the correct answer.

Explanation:

These are the main difference between RNA and DNA

Sugar present in RNA is ribose sugar whereas sugar present in DNA is deoxyribose sugar.

Nitrogenous bases present in DNA are adenine, guanine, cytosine, and thymine whereas in the case of RNA nitrogenous bases present are adenine, guanine, cytosine and uracil which is replaced by thymine in DNA.

RNA is single-stranded whereas DNA is a double-helix.

thus the all the above(D) options are correct.

Final answer:

RNA and DNA differ in three major areas: the types of sugars they contain, the bases they use, and their structure. RNA contains ribose sugars and the base uracil, while being single-stranded. In contrast, DNA contains deoxyribose sugars, the base thymine, and has a double helical structure.

Explanation:

RNA and DNA, which can both be found in cells, have several significant differences. To answer your question, the correct choice would be (d) all of the above because:

RNA has ribose sugar, while DNA has deoxyribose sugar. The difference is that the deoxyribose sugar in DNA is missing one oxygen atom compared to the ribose sugar in RNA.
RNA contains the base uracil whereas DNA uses the base thymine. This change makes DNA more stable and less likely to mutate.
Finally, RNA is single-stranded and DNA is a double helix. The double-stranded DNA is more stable resulting in a reduction in damage and loss of genetic information.

Learn more about Difference between RNA and DNA here:

brainly.com/question/32377763

#SPJ6

What units can be used to measure density?

Answers

Answer:

Kilogram per cubic meter

Explanation:

Hope this helps<3 i hope u have an amazing day luv

A student encounters a plant bearing small, purple flowers in the wild. The size of the flowers and the purple color are determined by two separate genes. The genes for both small size (S) and purple color (P) are dominant to large size (s) and white color (p), respectively. The student wants to determine the genotype of the newly isolated plant. Crossing to which of these plants would provide the most information in one generation? A. SSPP
B. SsPp
C. sspp
D. SSpp

Answers

Answer:

C. sspp

Explanation:

Crossing a plant of an unknown genotype with the one that is homozygous recessive for that gene is useful for revealing the unknown genotype and this is known as a testcross.
The result of the test cross can reveal whether the organism's genotype.
If the offspring of the cross shows dominant phenotype then the parent must be homozygous dominant and if the offspring shows recessive phenotype then the parent must be heterozygous.

Answer:

The answer is C.

Explanation:

Other Questions

What happens to any matter that is not used by consumers in a food chain?

Gregor Mendel’s research had formed the basis of the field ______.,A) genetics. B) dominance. C) recessiveness. D) selective breeding.

Choose a safe seafood choice for sushi. why is it safe?

Which biomolecule forms the cytoskeleton in cells? A LipidsB CarbohydratesС ProteinsD Nucleic Acids