If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

Answers

Answer 1

Answer: Thats a long one, but I got you!

A change in the DNA sequence, such as the mutation you described from 3' GTTACAGCACAGGGTAAACTC 5' to 3' GTTACAGCACAGGGTAAACGC 5', can have a significant impact on the protein produced. This specific type of mutation is called a "point mutation" or "single-nucleotide mutation" because it involves the substitution of a single nucleotide (in this case, a C for a T).

The impact on the protein depends on the role of the altered DNA sequence in encoding the protein. Here are the possible outcomes:

1. **Silent Mutation:** If the mutation does not change the amino acid encoded by the affected codon (a triplet of three nucleotides), it's considered a silent mutation. In this case, the protein's structure and function remain unchanged, as the altered DNA sequence still codes for the same amino acid.

2. **Missense Mutation:** If the mutation changes the codon to one that encodes a different amino acid, it's called a missense mutation. This can lead to an altered protein with potentially different properties or functions, depending on the nature of the new amino acid.

3. **Nonsense Mutation:** If the mutation changes a codon to a stop codon (a codon that signals the end of protein synthesis), it leads to a truncated protein. The protein will be shorter than the original, possibly lacking critical functional domains.

4. **Frameshift Mutation:** In cases where insertions or deletions of nucleotides occur (shifting the reading frame), it can result in a frameshift mutation. This often leads to a nonfunctional or drastically altered protein.

To determine the specific impact of the mutation, you would need to translate the altered DNA sequence into its corresponding amino acid sequence and assess how the change affects the protein's function, structure, and properties. The type of mutation and its consequences can vary, and it's essential to consider the specific genetic code and the context within the protein-coding region.

Related Questions

Suppose that a species of toads is introduced into a new environment in an attempt to reduce the populations of insects. The toad has no natural predators in the new environment. The toad population would most likelyA) Increase exponentially. B) Increase logistically.C) Decrease rapidly and die out.D) Remain the same.
Write a brief note on lymphatic system in human being.
The leaves stems and roots of a plant contain
What type of weathering do you think is more rapid in your area
All of the following require breaking and forming chemical bonds exceptgrilling a hamburger mixing vinegar and baking soda roasting a marshmallow bending a nail

Chemically speaking, enzymes are composed of chains of _________________, and they are considered to be a type of __________________.

Answers

All proteins are composed of amino acids. Each amino acid in a protein is linked by chemical bonds. Enzymes are composed of chains of amino acids. Enzymes are a type proteins that turn a cell into a highly developed miniature factory carrying out chemical reactions very fast.

Final answer:

Enzymes are composed of amino acids and are considered to be a type of protein.

Explanation:

Chemically speaking, enzymes are composed of chains of amino acids, and they are considered to be a type of protein.

Learn more about Enzymes here:

brainly.com/question/31561117

#SPJ6

What are the components needed in order for an experiment to be valid? Identify these components in the following experiment: A scientist is testing a new plant food to see if it causes plants to grow faster. The scientist tests two plants with the new plant food, and two plants he grows without plant food.

Answers

. Growing two plants without plant food at all doesn't count; in order to see if the new food is better, he must also grow plants with the original food in order to compare it.
have an independent variable. This is the type of plant food. It's independent because he has direct control over it.give plants the same conditions besides food: same water (amount), same light exposure, same temperature, etc.

choose a quantitative way to measure how much the plants grew, like mass or length.i need brainlest anwser to rank up help

Please explain how treadmilling contributes to actin-based motility in crawling cells. Be specific in why both actin filament growth a d shrinkage are necessary.

Answers

The actin filaments in cell constantly grow and shrink. This occurs through addition or removal of subunits. The two ends of actin filament have different dynamics of addition and removal of subunits. That way, one end of actin filament will grow and one end will shrink so it seems like the filament is moving. This phenomenon, known as treadmilling is characteristic for both actin filaments and microtubules.

Why is an organism’s niche like a person’s occupation?A) An organism makes “money” by working in its niche.
B) A niche is a “company” that the organism has to work in.
C) A niche is a “factory” where organisms build things.
D) An organism can “make a living” and survive in its niche.

Answers

D) An organism can “make a living” and survive in its niche.Because niche refers to an organisms role in an ecological system; its position in the environment - how it survives and multiply.

One reason why people should be aware of the impact of their actions on the environment is that

Answers

There is a nature law every actions has reaction. So when human being impact the environment in any way such as pollution, global warming etc., environment results to rise in the sea level or increase of disease that results to the death of the human beings.

What is environment?

Environment is defined as a sum total of all the non-living or living elements and their effects that influence human life.

Protect our water supply and keep our air cleaner and awareness in the people is only way to protect the environment. Other main important method to protect the environment is reuse, reduce, recycle.

For more details regarding environment, visit:

brainly.com/question/16654087

#SPJ2

if someone is aware of their actions on the environment that gives them the opportunity or the ability to change what their actions are there for bettering the environment

Which statement about enzymes is true

Answers

Enzymes don't take part in a reaction but just speeds up a reaction

Answer:

Explanation:

Enzymes don't take part in a reaction but just speeds up a reaction

Other Questions

Which structure provides energy to the cell? a. cytoskeleton b. mitochondria c. ribosomes d. endoplasmic membrane

In what form is energy lost from the ecosystem?A. Egestion B. Light C. Excretion D. Heat

Why does it take a long time to develop a new variety of tomato? A.Changes in traits happen gradually, over many generations. B.Many plants resist change. C.Tomatoes cannot acquire new traits. D.A species cannot change over time.

Which kingdom contains organisms that are multicellular, heterotrophic, eukaryotic, and lack cell walls?