Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
b. a river contaminated with the Giardia protozoan
c. a doorknob contaminated with the cold virus
d. an asymptomatic person infected with HIV
e. a mosquito infected with the malaria protozoan
Answer:
The correct option is: c. a doorknob contaminated with the cold virus
Explanation:
Fomites are the inanimate objects or substances that can get contaminated with the pathogens and are capable of transferring the pathogens to the new hosts.
Sterilization of the possible fomites should be done in order to prevent cross-infection.
Examples of fomites are hair, towels, clothes, door knobs, cups, switches, handrails, remote controls, pens, syringes, bedding, etc.
B. Members of Porifera lack endoderm and ectoderm
C. Sponges are a member of the phylum Cnidaria
D. Sponges do not reproduce by sexual reproduction and instead only reproduce asexually.
E. Given the following on the organism
I. An animal
II. Multicellular
III. Lacks tissues
IV. Lacks organs
V. Asymmetrical
This organism must be a member of the Phylum Porifera
Answer: Option E
Explanation:
Most of all poriferans/ sponges are suspension or filter feeders. Suspension feeders are organisms that each food materials which are suspended in their environment ie sea water, while filter feeders filter their food source from water by drawing water containing bacteria and organic matter in through their ostia(pores). Substrate feeders at organism that live in or on their food source.
Members of the poriferans do hava an ectoderm (epidermis) and an endoderm including a non-cellular late that is present in between the two layers.
No, they do not belong to the phylum cnidaria but porifera. Cnidarians including hydra, sex anemones, jellyfish etc and these have features that different from that of the sponges e.g the presence of nematocysts in cnidarians
Sponges can reproduce both sexually and asexually. Sexually by releasing larva fertilized in the sponge into water where they float around for some days and then proceed to adhere to a solid surface and begin their growth into adults. Asexually by budding
They are multicellular, lack tissues, are animals, lack organs and are asymmetrical. These are th distinguish features of poriferans
Answer: Option E.
Explanation:
Phylum porifera are group of organisms that live in aquatic habitats both marine and freshwater. They are diploblastic I.e they have two germ layers. They are assymetrical . They have round or vase-like or sac- like shape. They are multicellular and have bodies full of pores. They lack tissues and organs. Sponges are members of the phylum porifera.
Answer:
The correct answer is option - B.
Explanation:
Clams are the bivalve mollusks that are classified as a consumer or the filter feeder as they internalize the particles and the suspended nutrients and matter in the water to carry out energy and nutrients for them.
These are known as a consumer due to their bivalve body and get its specific structure which is using gills to filter the food or nutrients particle. This makes the clams unique as some other bivalves organisms.
Thus, the correct answer is option - B.
The strongest evidence that classifies clams as consumers is that they gain energy and nutrients by filtering particles from the water.
WHAT ARE CONSUMERS:
Learn more: brainly.com/question/15869639?referrer=searchResults
Answer:
It is an example of enzyme activation through the pH of the environment surrounding the enzyme.
This phenomenon is called proenzyme, proenzymes are inactive enzymes that, due to chemical changes in the environment that vary, are activated or not depending on these.
Explanation:
Proenzymes, generally the best known or named, are found in the digestive system, where the sequential digestion of food is essential, with an order, and the enzymes must be controlled or activated at certain moments of digestion.
Proenzymes can be activated by the presence of chemicals, pH acids and even pH alkalinity, the change of the medium is what gives the enzyme permission to start with its reaction effect.
Usually this happens with enzymes that must be controlled, and that their activity must be in certain periods so as not to generate pathologies or even destroy a tissue of the organism.
Living things are divided into five kingdoms: animal, plant, fungi, protist and monera. Living things are divided into five kingdoms: animal, plant, fungi, protist and monera.
The Hawaiian Islands were formed by a hot spot occurring in the middle of the Pacific Plate. While the hot spot itself is fixed, the plate is moving. So, as the plate moved over the hot spot, the string of islands that make up the Hawaiian Island chain were formed.
What is hotspot?
"In geology, hotspots (or hot spots) are volcanic locales thought to be fed by underlying mantle that is anomalously hot compared with the surrounding mantle".
What is Pacific plate ?
"The Pacific Plate is an oceanic tectonic plate that lies beneath the Pacific Ocean. At 103 million km2 (40 million sq mi), it is the largest tectonic plate".
To learn more about hotspot here
#SPJ2
Answer:
Explanation:
The Hawaiian Emperor seamount chain is a well-known example of a large seamount and island chain created by hot-spot volcanism. ... The Hawaiian Islands were formed by such a hot spot occurring in the middle of the Pacific Plate.