BIOLOGY HIGH SCHOOL

List the pros and cons of using integrated pest management (IPM).

Answers

Answer 1
Answer:

Hello, you can find the photo I took here, it should help. https://t.ly/MhKKA

Related Questions

A nucleic acid monomer consisting of three parts: a nitrogenous base, ribose (in rna) or deoxyribose (in dna), and a phosphate group is known as a ______.
In any ecosystem (what)are the point of the entry for new energy?
how is nitrogen from the atmosphere, the aiotic part of the ecosystem, converted into the biotic part of the ecosystem n organisms
If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?
What theory says that all living things are composed of cells? It also says that cells are the basic units of structure and function in living things and that new cells come from existing cells. A. Evolution B. Boveri–Sutton chromosome C. Genetic determinism D. Cell

A grown tiger began its life as a single fertilized egg. Explain why a tiger looks so much different as an adult than it did as a single fertilized egg

Answers

A tiger looks so much different as an adult than it did as a single fertilized egg because it developed through different stages from being a zygote (fertilized egg), to becoming an embryo (where it experiences intense cellular changes), to becoming a fetus (where it gains a great measure of cell specialization, and develops distinct tissues and organ systems). After birth, the tiger still undergoes further growth and development into adulthood. This is largely regulated by the expression of different genes at different times and also by environmental factors.
A tiger looks differently from the way it looked as a single cell because the cells split and make new cells, causing the life form to grow in size. Along with these cells come more genes, each varying due to purpose. To think, that a fully grown tiger started as a single cell, and is now much larger.

During a menstrual cycle, what is the purpose of the uterine lining buildup? dirty 230

Answers

If the egg is fertilised the embryo plants itself in the uterine lining. Without this it would not survive

Animals have more mechanisms for asexual reproduction than plants.
a. True
b. False

Answers

b.False. Animals usually reproduce sexually, most are not made to reproduce asexually. Plants reproduce asexually.

Which inheritance pattern results when parents are crossed for pure traits and the resulting offspring have traits that appear to blend?

Answers

The answer is incomplete dominance.

In incomplete dominance, heterozygous phenotype is intermediate between two homozygous phenotypes. In this case, the symbols for alleles are capital letters. For example, allele A is responsible for red color of a flower, allele B is responsible for white color of the flower. Red flower plants have AA genotype, and white flower plants have BB genotype. By crossing plants with red flowers and white flowers, due to incomplete variance, the offspring will be heterozygous plants (AB) with neither red nor white flowers, but pink flowers. Pink flowers have intermediate color between red and white flowers.


It should be distinguished from codominance in which both alleles are expressed in heterozygous conditions. In incomplete dominance, alleles are blended in heterozygous conditions.

: a pediatric fellow in your clinical practice group has identified a new clinical isolate of the gram-positive staphylococcus epidermidis that expresses a high level of an abc-type multidrug resistance (mdr) efflux pump. which of the following antibiotics would be the best choice for treating an infection caused by this bacterial strain? you may assume that the mdr efflux pump is its only resistance mechanism. all of the listed antibiotics would work well to treat ordinary staphylococcus epidermidis infections. choose one: a. rifampin b. tetracycline c. vancomycin d. sulfanilamide e. any of the antibiotics listed above would be effective choices. f. none of the antibiotics listed above would be effective choices.

Answers

None of the antibiotics indexed above could be a suitable pick for treating an infection  due to the bacterial strain described.

The gram-positive staphylococcus epidermidis that expresses a excessive degree of an ABC-type multidrug resistance (MDR) efflux pump is probably resistant to all the antibiotics indexed.

Rifampin, tetracycline, vancomycin, and sulfanilamide are all probable to be ineffective in this case because of its MDR efflux pump, which permits it to pump out those antibiotics and decrease their effectiveness.

In general, the best option for treating an infection due to a bacterial pressure with an MDR efflux pump could be an antibiotic that is not affected by the pump. Some alternatives for treating MDR infections encompass polymyxins (including colistin), tigecycline, and Fosfomycin.

However, the unique antibiotic that might be the best option for treating an infection due to this bacterial pressure could rely on the specifics of the contamination, including the area of the contamination and the patient's typical health. It is crucial to work with a healthcare professional to decide the most suitable remedy for an infection with an  MDR bacterial strain.

Read more about multidrug resistance at:

brainly.com/question/29106701

#SPJ4

Why are women often carriers of X-linked traits but rarely affected by them?

Answers

Women have two x chromosomes, compared to men who have one x and one y chromosome. Because of the two x chromosomes, one of them can override the other. In men they only have one x and one y, they don't have the extra x chromosome to override the allele.
Women have two X chromosomes.Recessive alleles on one X chromosome are often masked by dominant alleles on the other chromosome.Women will not be affected unless they receive two recessive alleles.
Other Questions
All of the following describe the image above except __________.A. neural communication B. neurotransmitter release C. hormone release D. nervous system functioning
Which phase change is the result of particles moving more quickly?liquid to gas liquid to solid gas to liquid gas to solid
Which best describes the importance of mitosis to living organisms?
What would happen to the food that someone ate if they didnt have the digestive enzymes they needed