Most protists are______.A)Unicellular
B)Heterotrophs
C)Autotrophs
D)Multicellular

Answers

Answer 1
Answer:

Answer:

Answer A

Explanation:

Fungus are usually single celled organisms.


Related Questions

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?
Explain how a starfish's body plan and anatomy's function very essential to its survival.
WILL MARK BRAINLIEST!!!! Can someone help me wit dis question? Summarize in 2-3 sentences the process of photosynthesis
Why are complex carbohydrates better for storing energy than simple sugars are?
Which of the following statements about cotransformation is true?A. Unlinked genes are passed simultaneously from one cell to another.B. Two bacterial cells within a culture are transformed by the same genetic material.C. A bacterial cell receives two adjacent genes on a single piece of DNA from the medium.D. It is not uncommon for the entire bacterial chromosome and F factor to be passed from one cell to another.

Describe the role of electrons in the formation of a covalent bond

Answers

electrons are shared between the non-metallic atoms

How are the parts of the solution mixed? A) chemically.

B) physically.

C) only in water.

D) by electronic means.

Answers

B) physically

The solute and the solvent are physically mixed/combined in a solution.

it would b B.physically because solution is a mixture and mixture is formed by physical change not by chemical

Use ribosomal RNA in a sentence

Answers

Ribosomal are found in living animals. Ribosomal produce protein. 

Cladistics is a way of classifying organisms by examining the characteristics of their ancestors and by depicting them in a cladogram. Which of the following best describes a challenge in classifying organisms this way ?A) millions of species on earth & cladogram not practical
B) impossible to tell which organisms are closely related on cladogram
C) cladograms are detailed oriented and impossible to show evolutionary relationships
D) there is limited number of ways to classify information some many of cladograms end up looking similar

Answers

Cladograms are detailed oriented and impossible to show evolutionary relationships and this among the following statements best describes a challenge in classifying organisms in this way. The correct option among all the options that are given in the question is the third option or option "C".

Ans. (C). cladograms are detailed oriented and impossible to show evolutionary relationships.

Cladistics can be defined as a method to biological classification, by which organisms are categorized in different groups on the basis of most common recent ancestor.

Cladograms only provide relations between different organisms on the basis of physical appearance and do not show genetic constitute of organisms.

Thus, the correct answer is option (C).

cat fur color is determined by codominance the allele for tan fur (TT) and the allele for black fur (BB) are codo

Answers

what does that even mean

How long was Bruno jailed and tortured

Answers

Giordano Bruno was jailed and tortured for about 7 years. His trial continued for 7 years and for the full period of time he remained imprisoned. he was found guilty of the charges brought against him. Later on he was given the death sentence. He actually became famous because of the work he did, after his death.