Answers
Answer:talk about how fascinating Nature is in all of the good qualities it’s good to preserve nature for animals and to make the world last longer with things like pollution and go on from there
Explanation:
Related Questions
How many grams of carbohydrate per day are recommended for adults 19 years and older? A. 75 grams B. 100 grams C. 130 grams D. 160 grams
3. How many times can the nuclear DNA replicate during the life cycle of a cell? *AlwaysOnly onceTwiceMany times
Science In a cell, what is the function of the cell membrane?OA. It only maintains the cell shape.ОВ.It removes waste and stores ingested food.OC. It generates energy for the cell.OD.It controls the entry and exit of substances.Have a good day ❤️
One true-breeding line of mice is obese and dark and another is lean and light. Dark is dominant to light, but obese and lean exhibit incomplete dominance. What proportion of offspring from a dihybrid cross should be both dark and intermediate between obese and lean
Answers
Answer:
Alt control delete XD
Explanation:
just because but ik how you can get you answer just go to answerme.com
Monosaccharides
Fatty acids and glycerol
Amino acids
Water
Ca2+ , Na+ , Ca2+
Answers
Answer:
The absorption of monosaccharides takes place via facilitated and cotransport mechanism and is transported through blood capillaries present in the villi.
The absorption of glycerol and fatty acids takes place through diffusion and the majority of them are transported via lymph capillaries, while some are transported through blood capillaries.
The absorption of amino acids takes place via a cotransport mechanism with sodium ions and is transported through blood capillaries.
The absorption of water takes place by the process of osmosis via diffusion and is transported with the help of blood capillaries.
The absorption of calcium and sodium ions takes place via an active transport mechanism, while the absorption of chlorine takes place via the process of diffusion. The transportation of all these ions takes place with the help of blood capillaries.
Final answer:
Monosaccharides, amino acids and ions are generally absorbed through active transport into the blood capillaries, while fatty acids and glycerol are transported into the lymphatic capillaries. Water is absorbed via osmosis into both the blood and lymph capillaries.
Explanation:
The absorption mechanisms of the various food breakdown products are different and determine whether they move into the blood capillaries or into the lymphatic capillaries. This absorption is either through passive or active transport.
- Monosaccharides like glucose are absorbed through active transport into the blood capillaries.
- Fatty acids and glycerol are also absorbed into the cells lining the small intestine, they are then reassembled into fats and transported into the lymphatic capillaries.
- Amino acids are absorbed through active transport into the blood capillaries.
- Water is absorbed mainly via osmosis, a type of passive transport, into both the blood and lymph capillaries.
- Ions (Ca2+, Na+, Ca2+) are absorbed through active transport into the blood capillaries.
Learn more about Absorption of Food Breakdown Products here:
#SPJ3
Answers
We have to remind them that ASL is their language and itdoes not reflect their intelligence. Language variation in the Deaf World iscalled register. Register refers to variation in language according to theformality or informality. Intimate, casual, consultative, formal, andfrozen. Some Deaf feel low when they usestrong ASL, feeling that they do not have good English.
B. The tendency of water to minimize its contact with nonpolar substances is called the hydrophobic effect.
C. Hydrophobic molecules are individually hydrated in water, increasing the entropy of the system.
D. Hydrophobic molecules clump together in water because fewer water molecules are required to surround them, which results in a smaller decrease in entropy than if the molecules were individually hydrated.
E. Nonpolar molecules are capable of forming micelles.
Answers
Answer:
Answer : A, B and D
Explanation:
Amphipathic lipids are lipids that have bothe polar and non-polar parts or end. The polar part is the part which is described as hydrophilic i.e water loving, while the non-polar part is described as hydrophobic, meaning water fearing.
Most or all hydrophobic molecules clump together in water in order to prevent water from surrounding the molecules. This means that, they do not break the hydrogen bond in the water. This is known as hydrophobic effect.
In this case, it will be discovered or concluded that, the three options, A, B and D, are the statements that are considered to be true.
Answer:
The three of the statements which are true includes A,B,and D.
A. Amphipathic (amphiphilic) lipids are the structural basis of biological bilayer membranes.
B. The tendency of water to minimize its contact with nonpolar substances is called the hydrophobic effect.
D.Hydrophobic molecules clump together in water because fewer water molecules are required to surround them, which results in a smaller decrease in entropy than if the molecules were individually hydrated.
Explanation: option E is wrong because micelles are formed by amphipathic molecules like Lipids not non polar molecules. Option C is wrong because water molecules involved in hydration cannot participate in normal hydrogen bonding with one another.
Answers
Answer:
porosity,minerals of softness,ease of dissolving
Explanation:
Answer:
Moisture B
Explanation:
At least I think, Dont be mad if you get it wrong tho LOL sorry guys.
Answers
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.