What do all multicellular organisms begin as?

Answers

Answer 1
Answer: When alot of cells are put together.

Related Questions

9. List the steps of cellular respiration in order
What excess from the body does respiration eliminate? a. pleura b. oxygen c. carbon dioxide d. alveoli
EOC Biology. A strand of DNA contains the sequence GGC-CAT. What is the complementary strand of mRNA for this sequence? Please help
The sigmoidal relationship between prey density and per capita predation rate in a Type III functional response can be explained by all of the following factors, except(A) Predator density.(B) Predator preference of prey switches.(C) Prey access to refuge.(D) Recognition of prey by predator.
If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

A cross is performed between a plant with genotype ttyy and a plant with genotype ttyy. if the two genes independently assort, what is the probability, expressed as a decimal, that the offspring will be homozygous for gene t and homozygous for gene y?

Answers

The given question says a cross is performed between two homozygous recessive individual, both having genotype ttyy.

In any case, the gametes produced by these plants would be recessive for the trait and the cross between these individual would always give rise to a homozygous recessive progeny.

Hence, in any case, the progeny would be homozygous for allele t, and allele y.

So, the probability of offspring having homozygous for gene t and homozygous for gene y would be 100% or 1.

Freshwater biomes have _______.a. organisms adjusted to high salinity
b. more diversity than marine biomes
c. a salinity of less than 1%
d. the ability to maintain their temperature year round

Answers

The right option is; c. a salinity of less than 1%

Freshwater biomes have a salinity of less than 1%

The freshwater biome is a large community of plant and animals that live in water bodies with a salinity of less than 1%. Fresh water biomes include streams, rivers, ponds, lakes, and some wetlands. The fresh water biomes cover about 20% of the earth and they contain several species of fish and animals such as frogs, crocodiles and turtles.


Final answer:

Freshwater biomes have a salinity of less than 1%. They do not support more diversity than marine biomes and don't maintain constant temperatures throughout the year.

Explanation:

Freshwater biomes, spanning rivers, lakes, and ponds, are characterized by a salinity of less than 1%. Unlike marine biomes with high salinity, the organisms inhabiting freshwater biomes have adapted to live in low salinity conditions. Notably, freshwater biomes do not have more biodiversity than marine biomes - marine biomes are known for their rich species diversity. Additionally, freshwater biomes lack the ability to maintain their temperature year-round; they are subject to seasonal fluctuations in temperature.

Learn more about Freshwater Biomes here:

brainly.com/question/33274794

#SPJ6

What is the meaning of virus?

Answers

It is basically a cell that multiply only with another one of itself. 

Answer:

A virus is something that can be spread. It tricks your immune system into thinking its a cell, then it goes into a cell to replicate itself and attack your immune system. This is the way you get sick from a virus.

Vesicles that contain a cells digestive enzymes are called ?

Answers

vesicles that contain a cells digestive enzymes are called lysosomes
It is lysosome.
.......................................

The accelerated growth and advances in taxonomy as a science occurred during

Answers

The accelerated growth and advances in taxonomy as a science occurred during the Renaissance when numerous medical and biological advancements were made.

Magma that cools very slowly deep beneath the surface forms minerals with what type of crystals

Answers

Magma that cools slowly forms intrusive crystals that are very fine-grained.