BIOLOGY HIGH SCHOOL

In which step of the scientific method is information obtained through the senses?a. drawing conclusions
b. making observations
c. analyzing data
d. revising a hypothesis

Answers

Answer 1
Answer: The scientific method of making observations is how information isobtained through the senses. A person can see, touch, smell and hearthings in order to make an educated guess to how things will end uppanning out for whatever scientific things they are researching.
Answer 2
Answer:

Making observations is the step of scientific method in which information is obtained through the senses.  

Making an observation is the first step of scientific method where scientists gets curious about a natural occurrence or a phenomenon.

Further Explanation.

  • Scientific method involves a process where researchers or scientists search for answers to certain questions and solutions to problems.
  • Scientific methods are used by scientists or researchers to test a given hypothesis.

Steps involved in Scientific method

Making an observation and asking question.

  • Making observation is the first step of any scientific process. The scientists make observations about a natural phenomenon.
  • After making observations scientist asks a question about an observed phenomenon or pattern.  
  • Observations may be qualitative where the occurrences are described in ways that do not use numbers or quantitative where observations contain numbers and other features.

Formulating a hypothesis

  • Hypothesis refers to probable answers to the question asked and one that can be tested experimentally. Hypothesis is therefore a possible explanation for a given observation or occurrence.
  • For the observation that we experience alternating periods of light and darkness that correspond to the movement of the sun, moon, and clouds. The hypothesis here would be; The earth rotates on its axis for 24 hours, thus, exposing one side to the sun or else the sun revolves around the earth for twenty four hours.

Designing and performing experiments

  • Suitable experiments be carried out  to test the  validity of the hypothesis formulated.
  • Experiments refers to organised measurements or observations normally made under controlled environment.

Accept or modify the Hypothesis  

  • The experiment conducted helps the researchers or scientists to determine whether the hypothesis formulated is valid. If the hypothesis is valid then they proceed to the next step of scientific method.
  • However, if the experiments demonstrate that the hypothesis is incorrect then it must be corrected for further experimentation.

Developing a law and/or a theory  

  • After conducting experiments and analyzing the results obtained, the researchers may test whether the results are reproducible and hence a law may formulated to allow general prediction.
  • A scientific law describes a phenomenon or pattern, it describes what happens but does not explain why.

Key words: Scientific method, making observation

Learn more about;  

  1. Scientific method; brainly.com/question/1506591
  2. Steps involved in scientific method: brainly.com/question/1506591

Level: high school  

Subject: Biology

Topic: scientific method  

Sub-topic: steps involved in scientific method

Related Questions

What is the funsion of the chloroplast
Most land mammals have the ability to rest one hemisphere of their brains at a time. Please select the best answer from the choices provideda. True b. False
Bacteria grow well on the surface of cut fruit or vegetables. a. True b. False
Which of the following transfers would be expected to have the most efficient energy transfer?A) lions eating a zebraB) wolves eating a mooseC) hawk eating a fishD) crocodiles eating a buffalo
The difference between osmosis and diffusion is that osmosis is the spreading of water from a high to low concentration while diffusion is the spreading of molecules or particles from a high to low concentration.

Explain how a population of insects could become resistant to a pesticide.

Answers

The pesticide is sprayed, and only those that can withstand it survive while the others perish. Those who can withstand it generate offspring who can withstand it.

Why Are pesticides harmful?

Pesticides have the potential to pollute lawn, water, as well as other vegetation. Herbicides can be poisonous to a variety of different organisms in contrast to insects and plants, such as birds, fish, helpful invertebrates, and quasi plants. staying inside the rooms where bug sprays are being used or bringing inside household items designed for the outdoors.

Why should pesticides be banned?

Pesticides have the potential to pollute turf, water, soil, and other plant life. In addition to destroying weeds or insects, pesticides can be poisonous to a variety of other animals and plants, including fish, birds, beneficial insects, and non-target plants. residing in the areas where foggers are utilized or bringing indoor-use items inside your home. Any substance "designed for avoiding, eliminating, repelling, or reducing any pest" is referred to as a pesticide.

To know more about Pesticide visit:

brainly.com/question/24316938

#SPJ2
when the pesticide is sprayed, the ones that can resist live and the others die. The ones that can resist it produce offspring that can also resist it

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Review the numbered items below. Then, decide which of the following lists the correct steps of translation in the correct chronological order. I. UGA codon is identified.
II. DNA is unwound to expose a single template strand.
III. tRNA molecules carrying various amino acids bond to mRNA based on the sequence of mRNA codons.
IV. mRNA arrives at the ribosome
V. Introns are snipped out of an mRNA molecule.
V. tRNA, carrying methionine amino acid, bind to mRNA.

Answers

Answer:

IV, VI, III, I

Explanation:

Translation is the process of synthesis of protein from with the help of messenger RNA (mRNA).

The process of translation include initiation, elongation and termination.

  • Initiation: In this step mRNA binds to ribososomes and tRNA, carrying start codon or methionine binds to mRNA.
  • Elongation:In this step, the tRNA molecules carrying several amino acid bind to mRNA based on the sequence of mRNA codon and then moves (translocates) to the next mRNA codon which leads to amino acid chain.
  • Termination: At the end, when a stop codon (UGA) identified, polypeptide is released.

So, the correct chronological order is IV, VI, III, I.

What is the most important role of lipids?

Answers

Explanation:

The most important role of lipids is the fats, phospholipids, waxes, and steroids. Lipid is a compound that contains carbon and hydrogen and is used to store energy, provide structure, and transmit information. Fats are stored in adipose tissue. Adipose tissue a group of cells that store fat, generally found under the skin and around organs.

Phospholipids are the main component of cell membranes. Waxes provide a waterproof coating on leaves and feathers. Steroids are part of cell membranes and chemical messengers in the body. It has long-term energy storage, provides insulation and protection.
they are used mostly as a barrier

Select all the answers that apply.Geological evidence of the age of the earth includes _____.

radiometric dating of rocks
fossil evidence
comparative anatomy
molecular clocks
gradual processes of rock formation

Answers

Answer;

  • radiometric dating of rocks
  • fossil evidence
  • gradual processes of rock

Explanation;

Radiometric dating confirms that Earth is ancient and explains how extremely slow processes can result in major changes to Earth’s surface. Evidence from radiometric dating indicates that Earth is about 4.54 billion years old. The geology or deep time of Earth's past has been organized into various units according to events which took place.

-The ages of Earth, Moon, and meteorites, radiometric dating has been used to determine ages of fossils, including early man, timing of glaciations, ages of mineral deposits, recurrence rates of earthquakes and volcanic eruptions, the history of reversals of Earth's magnetic field, and the age and duration of a wide variety of other geological events and processes.
radiometric age dating of meteorite material and is consistent with the radiometric ages of the oldest-known terrestrial and lunar samples and
fossil evidence

What happens to the amount of biomass at each tropic level ?

Answers

organisms tend to be larger in size at higher trophic levels, but their smaller numbers result in less biomass. biomass is the total mass of organisms at a trophic level.
Other Questions
BRAINLIEST ✨✨✨You can use the half-life Gizmo to model the decay of Carbon-14, which has a half like of approximately 6,000 years.Use the Gizmo to estimate the age of each of the objects below For these questions, each second in the Gizmo represents 1,000 years.
What cells were chloroplast present in? What did they look like in the various cells? Be specific.
Please help me......
What inhibits RNA polymerase II?