Which of the following is true about how thermal energy moves?1.Thermal energy moves to an object with the same amount of heat.
2. Thermal energy moves to an object with less heat.
3.Thermal energy moves away from an object with less heat.
4.Thermal energy does not move.

Answers

Answer 1
Answer:

The statement that is true about thermal energy moves is thermal energy moves to an object with the same amount of the heat. Thus, option A is correct.

What is Renewable Energy?

Renewable Energy is the sources that are natural sources of energy and has zero emission in comparison to the fossil fuels. As Sun light is natural and will last forever. Taking long, hot showers. As this activity is resulting in waste of energy it can not show energy conservation.

Conservation of Energy is defined as or According to the law the total of all the energy in an isolated system remains constant i.e. conserved. Turning off the lights when you are not in a room. As this activity is resulting in saving energy.

Stored energy has been known as the potential energy has the energy stored or held by any object because of its position. Always to a place of lower thermal energy. The flow of thermal energy causes heat and it always moves from high temperature to low temperature.

Therefore, option A is correct.

Learn more about temperature on:

brainly.com/question/11464844

#SPJ3

Answer 2
Answer: The answer is 1.Thermal energy moves to an object with the same amount of heat.

♡♡Hope I helped!!! :)♡♡

Related Questions

What is a composite material used to make strong structures like bridges
What is the scientific name for sugar-apple?
If data point is way off the trend line which of the following will NOT help resolve the problem?a. Discard the data pointb. Check for a mistake in recording the datac. Run the experiment again to verify the accuracy of the original data.
If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?
Which of the following statements about eutrophication is NOT true?(A) It is caused by acid rain. (B) It is caused by the addition of nutrients to a water system. (C) It is most harmful when there is little flow through in the system. (D) Phosphorus is the main causal agent. (E) Humans are responsible for most eutrophication.

The amount of energy a person can consume throughout the day without gaining weight is extremely dependent onA. hunger.
B. appetite.
C. culture.
D. activity level.

Answers

D. because if you eat a lot you must be active of els you will gain pounds

Which explanation is most likely an effect of the evolution of a larger brain in humans? A larger brain allowed humans to use tools. A larger brain allowed humans to solve complex problems. A larger brain allowed humans to better survive disease. A larger brain increased humans' ability to fight.

Answers

Answer:

The correct answer is the option: A larger brain allowed humans to solve complex problems.

Explanation:

Hello! Let's solve this!

Evolution shows that characteristics have developed over time that have allowed living things to survive in the environment.

In this case, it involves the size of the brain. The brain grew so that the human being could solve more complex problems.

We conclude that the correct answer is the option: A larger brain allowed humans to solve complex problems.

Answer:

A larger brain allowed humans to solve complex problems.

Explanation:

What is the primary source of energy for all
living organisms?

Answers

Answer: the sun

Explanation:

Please give me 5 stars!! :)

Thw primary source is the Sun

Describe three new technologies or products that you can use if you want to conserve energy.I would like everyone to list 3 of either technologies or products
best answer gets brainliest!!!!! GO GO GOOOOOO!!!!


XD oof

Answers

Hybird and electric cars, uses fewer fossil fuel resources, and create less pollution. CFL light bulbs last 10 times longer than traditional bulbs, and uses less energy. Energy-efficient appliances like washing machines that reqiure less water and use less power.

Well, there's many new technologies we can use in our everyday lives to conserve energy, such as...


  • A solar water heater
  • Solar panels
  • Wind generators
  • Or even a rainwater harvesting system!

I hope these were good enough!

In this excerpt from the poem "Learning to Read" by Frances Ellen Watkins Harper, what is the meaning of the word rising?And said there is no use trying,
Oh! Chloe, you're too late;
But as I was rising sixty,
I had no time to wait.

A. advancing

B. approaching

C. increasing

D. elevating

E. succeeding

Answers

The correct option is B.
To be rising means to be going up or to be increasing. Based on the way the word 'rising was used in the given excerpt, the word implies approaching. What the character in the poem was trying to say is that, since he is approaching his 60th birthday, he felt that time is going and he can not afford to waste anytime again, so he set out to accomplish his desires.

Answer: B. approaching.

Explanation:

  • The word approaching means to come near to a certain distance, time or anything else.
  • In the given excerpt, the word rising is placed before sixty which indicates the age.
  • In the given poem the character is saying "but as I was rising sixty" this means that the word rising points out to reaching the age of sixty and because the word approaching means to come near to something, it is the most appropriate answer.

Which of the following will occasionally produced a duplicate gene

Answers

Crossing-over during meiosis will occasionally produce a duplicate gene.