When brown iodine is exposed to starch it turns dark purple. In an experiment, you placed a cornstarch solution in a small bag made of dialysis tubing. Next, you placed the bag in a beaker of water containing 10 drops of iodine. If the solution in the dialysis tubing bag turned dark purple (Select all that apply). a. The plastic bag was permeable to cornstarch.

b. Aces the plastic bag was permeable to iodine.

c. The iodine moved into the plastic bag.

d. The cornstarch moved into the beaker.

e. The plastic bag was selectively permeable.

Answers

Answer 1

Answer:

The solution in the dialysis tubing bag turning dark purple indicates that the iodine has moved into the bag and reacted with the cornstarch. This means that options (b) and (c) are correct.

The dialysis tubing bag is selectively permeable, which means that it allows certain molecules to pass through while blocking others. In this case, the bag is permeable to iodine molecules, but not to larger molecules such as cornstarch. Therefore, option (e) is also correct. The cornstarch did not move into the beaker, as the bag is designed to keep its contents inside. Therefore, option (d) is incorrect. The fact that the solution in the bag turned purple indicates that the bag was permeable to cornstarch, as it allowed the iodine to come into contact with the cornstarch and produce the purple color. Therefore, option (a) is also correct.

Because the solution in the bag turned purple as a result of the iodine's contact with the cornflour, it can be concluded that the bag was permeable to cornflour. This contact enabled the purple colour to be produced. As a result, choice (a) is also accurate.

To learn more about cornstarch solution refer to:

brainly.com/question/28549502

#SPJ4

Related Questions

Oxygen is released as a waste product by plants during the process of
Unlike most mites, termites can digest wood. This ability comes from protozoa that live in the a termite’s digestive tract. These protozoa produce enzymes that digest wood, and they receive shelter and additional nutrients from the termites. The interaction between termite and protozoan is called A) commensalism. B) mutualism. C) parasitism. Eliminate D) socialism.
I need help on the second one
Which of the following could result in secondary succession?a. the formation of a tall sand dune on a previously grassy beach b. a vast glacier in motion forming a U-shaped valley on its wake c. a volcanic eruption that covers most of what used to be a forest d. an introduced species that devastates native plants as it feeds
The human genome project enables researchers to pinpoint diseas causing genes and possibly prevent or treat them

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

Answers

Thats a long one, but I got you!

A change in the DNA sequence, such as the mutation you described from 3' GTTACAGCACAGGGTAAACTC 5' to 3' GTTACAGCACAGGGTAAACGC 5', can have a significant impact on the protein produced. This specific type of mutation is called a "point mutation" or "single-nucleotide mutation" because it involves the substitution of a single nucleotide (in this case, a C for a T).

The impact on the protein depends on the role of the altered DNA sequence in encoding the protein. Here are the possible outcomes:

1. **Silent Mutation:** If the mutation does not change the amino acid encoded by the affected codon (a triplet of three nucleotides), it's considered a silent mutation. In this case, the protein's structure and function remain unchanged, as the altered DNA sequence still codes for the same amino acid.

2. **Missense Mutation:** If the mutation changes the codon to one that encodes a different amino acid, it's called a missense mutation. This can lead to an altered protein with potentially different properties or functions, depending on the nature of the new amino acid.

3. **Nonsense Mutation:** If the mutation changes a codon to a stop codon (a codon that signals the end of protein synthesis), it leads to a truncated protein. The protein will be shorter than the original, possibly lacking critical functional domains.

4. **Frameshift Mutation:** In cases where insertions or deletions of nucleotides occur (shifting the reading frame), it can result in a frameshift mutation. This often leads to a nonfunctional or drastically altered protein.

To determine the specific impact of the mutation, you would need to translate the altered DNA sequence into its corresponding amino acid sequence and assess how the change affects the protein's function, structure, and properties. The type of mutation and its consequences can vary, and it's essential to consider the specific genetic code and the context within the protein-coding region.

What proportion of alleles do identical twins have in common

Answers

Identical twins have 100% of alleles in common.

Maple trees are often tapped to extract the sap to make syrup. Which type of tissue is the aim of the tree tap? A) dermal
B) meristem
C) ground
D) vascular

Answers

D. Vascular tissue

Vascular tissue is known to be a complex conducting tissue that is formed by the arrangement of multiple cell types in vascular plants. Thus, the transportation of minerals, water and other products of photosynthesis occurred through the vascular tissue which is transported throughout the plant. However, both xylem and phloem are primary component of vascular tissue.

Answer: D. vascular

The maple trees are commonly tapped in order to extract its sap and make it into a syrup. The aim of the maple tree tap is the tissue of the tree known as the vascular tissue. These tissues resemble like pipes that transport fluids within the plant.

A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair

Answers

GACTCCGTAACGGTTAACC. CTGAGGCATTGCCAATTGG G- pairs with C. A- pairs with T. Unless it is mRNA then A pairs with U.

if there were no suppression of dna replication between meiotic divisions but cytokinesis proceeded normally, what is the most likely outcome of meiosis?

Answers

The answer is 4 diploid cells.

Meiosis is a cell division which results in the reduction of chromosome number by half - from diploid to haploid - in daughter cells. It consists of meiosis I and meiosis II. Meiosis I produces two haploid cells. Meiosis II is analogous to mitosis, so in total, meiosis results in four haploid cells. This is achieved through suppression of DNA replication between two meiotic divisions.
If there were no suppression of DNA replication, then meiosis I would produce two diploid cells, and after meiosis II there will be four diploid cells.

If one amino acid in a sequence of several hundred is changed, a mutation can result. a. True
b. False

Answers

this is true
if one single amino acid is changed then the result can be a mutation.

Answer:

true

Explanation:

Other Questions

What cbrne agent are microorganisms and/or biologically derived compounds or molecules that cause disease in personnel, plants, or animals?

A fossil bone is tested, and no c-14 is found. What can be said about the fossil's age?A.it's 5,730 years old B.it's less than 5,730 C.it's more than 5,730

Which of the following is the correct matching nucleotide sequence for GATAC?

in grammatically correct sentences trace the path of reactants for photosynthesis as they enter the leaf