In the DNA isolation process, cells are mixed with sodium chloride (i.e. NaCl) because the sodium (Na ) neutralizes the negative charge of DNA.a. True
b. False

Answers

Answer 1
Answer:

It is true that in the DNAisolation process, cells are mixed with sodium chloride (i.e. NaCl) because the sodium (Na ) neutralizes the negative charge of DNA.

What is DNA isolation?

DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellularcomponents using physical and/or chemical methods from a sample. In 1869, Friedrich Miescher isolated DNA for the first time.

The ability to extract DNA is critical for studying the genetic causes of disease and developing diagnostics and drugs.

It is also required for forensicscience, genome sequencing, detecting bacteria and viruses in the environment, and determining paternity.

Because sodium (Na+) neutralizes the negative charge of DNA, cells are mixed with sodium chloride (i.e. NaCl) during the DNA isolation process. It makes homogenization easier.

Thus, the given statement is true.

For more details regarding DNA isolation, visit:

brainly.com/question/13126093

#SPJ2

Answer 2
Answer:

Answer:

this is true it neutralise easily


Related Questions

From the bacteria's perspective, why is it helpful that it produce diarrhea in people?A. Because it gets the bacteria out of the person and, likely, into the next oneB. It's not helpful really. That's just what that toxin causes.C. Because that quickly kills the personD. Because it makes the patient too unpleasant to be aroundE. Because there is no real treatment for that
Which of the following scenarios describes an example of epistasis?
According to the chemical equation, what happens to potassium feldspar during hydrolysis?
What is the only difference between the control group and the experimental group in a controlled experiment? a The Test b The Prediction c The Variable d The Hypothesis
Nuris is writing a paper on the scientist who first named cells after studying cork under a microscope. Who is her paper about?A. VirchowB. SchwannC. HookeD. Leeuwenhoek

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode and sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion

Answers

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

What makes ribosomal RNA useful as a molecular clock? (2 points) A large portion of the DNA ring is not vital to structure or function, allowing it to accumulate neutral mutations. Its rate of mutation increases over time as organisms continue to evolve and differentiate from each other. A slow mutation rate makes it useful for determining evolutionary relationships between ancient species. It is only found in select organisms, making it easier to compare relationships between species that have it.

Answers

Answer:

The correct statement is that a slow mutation rate makes it useful for determining evolutionary relationships between ancient species.

Explanation:

The rRNA or ribosomal RNA has an application as a molecular clock because of many factors. It exhibits a very slow mutation rate, that is, around one million years because of which it stays highly conserved in all the organisms. In the ribosomal RNAs of two organisms, the degree of mutations can be associated directly with the time they were originated in the past.  

In supplementation, it possesses essential biological function because of which it can be witnessed in almost all the species.  

Answer:

A slow mutation rate

Which key feature of living organisms is best described as the transmission of DNA from parent to offspring?

Answers

I think the answer is Sunlight

Final answer:

Heredity refers to the process in which DNA is transmitted from parent to offspring, determining trait inheritance. DNA contains the genetic information that informs the traits of the offspring.

Explanation:

The key feature of living organisms that is best described as the transmission of DNA from parent to offspring is called heredity. Heredity is a fundamental biological process that refers to the passing on of genes from one generation to another. Within this process, DNA plays a crucial role as it contains the genetic material that determines the traits of an offspring. For example, you might have the same eye color as your mother because she passed on the specific sequence in her DNA that determines eye color

.

Learn more about Heredity here:

brainly.com/question/34600691

#SPJ2

Discuss briefly, the different factors that can affect the rates of chemical reactions in our body.

Answers

Answer:

Factors that can affect the rate the rates of chemical reactions in the body are temperature, substrate concentration and presence and absence of enzymes.

Explanation:

Rate of a reaction may be defined as the speed of the reaction or the rate at which reactants are converted into products.

Increase or decrease in the range of temperature can affect the rate of a chemical reactions of the body. With increase in the temperature the rate of a reaction increases as the effective collision between the substrate increases and then decreases.

Enzymes are the biocatalyst that can increase the rate of a chemical reaction. The absence of the enzymes decreases the rate of a reaction.

The increase in the concentration of substrate increases the rate of a chemical reaction of the body.

7. Explain how protist are thought to have given rise to multicellular organisms.

Answers

Protists belong to the group eukaryotes (having their DNA enclosedinside the nucleus). They are not plants, nimals or fungi but they act likeone. They can be in general subgroups such as unicellular algae, protozoa andmolds. 

May someone please help me on this ?

Answers

Answer:

C- active B- diffusion A- facilitated

Explanation: