It is true that in the DNAisolation process, cells are mixed with sodium chloride (i.e. NaCl) because the sodium (Na ) neutralizes the negative charge of DNA.
DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellularcomponents using physical and/or chemical methods from a sample. In 1869, Friedrich Miescher isolated DNA for the first time.
The ability to extract DNA is critical for studying the genetic causes of disease and developing diagnostics and drugs.
It is also required for forensicscience, genome sequencing, detecting bacteria and viruses in the environment, and determining paternity.
Because sodium (Na+) neutralizes the negative charge of DNA, cells are mixed with sodium chloride (i.e. NaCl) during the DNA isolation process. It makes homogenization easier.
Thus, the given statement is true.
For more details regarding DNA isolation, visit:
#SPJ2
Answer:
this is true it neutralise easily
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The correct statement is that a slow mutation rate makes it useful for determining evolutionary relationships between ancient species.
Explanation:
The rRNA or ribosomal RNA has an application as a molecular clock because of many factors. It exhibits a very slow mutation rate, that is, around one million years because of which it stays highly conserved in all the organisms. In the ribosomal RNAs of two organisms, the degree of mutations can be associated directly with the time they were originated in the past.
In supplementation, it possesses essential biological function because of which it can be witnessed in almost all the species.
Answer:
A slow mutation rate
Heredity refers to the process in which DNA is transmitted from parent to offspring, determining trait inheritance. DNA contains the genetic information that informs the traits of the offspring.
The key feature of living organisms that is best described as the transmission of DNA from parent to offspring is called heredity. Heredity is a fundamental biological process that refers to the passing on of genes from one generation to another. Within this process, DNA plays a crucial role as it contains the genetic material that determines the traits of an offspring. For example, you might have the same eye color as your mother because she passed on the specific sequence in her DNA that determines eye color
.
#SPJ2
Answer:
Factors that can affect the rate the rates of chemical reactions in the body are temperature, substrate concentration and presence and absence of enzymes.
Explanation:
Rate of a reaction may be defined as the speed of the reaction or the rate at which reactants are converted into products.
Increase or decrease in the range of temperature can affect the rate of a chemical reactions of the body. With increase in the temperature the rate of a reaction increases as the effective collision between the substrate increases and then decreases.
Enzymes are the biocatalyst that can increase the rate of a chemical reaction. The absence of the enzymes decreases the rate of a reaction.
The increase in the concentration of substrate increases the rate of a chemical reaction of the body.
Protists belong to the group eukaryotes (having their DNA enclosedinside the nucleus). They are not plants, nimals or fungi but they act likeone. They can be in general subgroups such as unicellular algae, protozoa andmolds.
Answer:
C- active B- diffusion A- facilitated
Explanation: