Please I need help with this
Please I need help with this - 1

Answers

Answer 1
Answer: TAAGCCGATAAATGCTAACGGTA

Related Questions

A complete circuit contains two parallel-connected devices and a generator for providing the electromotive force. The resistance of the first device is 12 ohms, the resistance of the second device is 4 ohms, and the voltage developed by the generator is 40 V. What is the magnitude of the current flowing through the first device? A. 10 A B. 13.32 A C. 8 A D. 3.33 A
In what structures do the enzymes actually chemically digest food?
Hi I need help fast!! please look at my picture ! Thank you
1. Which of these processes is responsible for generating the most ATP within cellular respiration?A. The electron transport chainB. The breakdown of glucose into pyruvic acidc. Krebs cycle2. Within the light-independent reactions, what can be said about the 3-carbon-atom molecules produced?A. Some of these molecules are converted back into 5-carbon-atom molecules to regenerate the cycle.b. All of these molecules leave the cycle to make sugars.c. All of these molecules are combined with carbon dioxide.3. Which of the following accurately describes the patterns of inheritance in human blood types?A. Three alleles code for blood types and three phenotypes are possible.B. Allele IA and IB are codominant, and allele i is recessive.c. Allele i is dominant over alleles IA and IB.4. A cell can only grow so large in size, becauseA. its surface-to-volume ratio decreases as the cell becomes larger.b. its ability to exchange materials would happen more quickly as the cell grows.c. its surface-to-volume ratio decreases as the cell becomes smaller.5. Which of the following accurately describes the relationship between photosynthesis and cellularrespiration?a. Cellular respiration provides photosynthesis with oxygen and sugar.b. The reactants of photosynthesis are the products of cellular respiration and vice versa.c. All living organisms must choose only one of these processes for their entire lives.
13. Which of the following is not required by animals to control body temperature? A. Animals must switch between ectotherm and endotherm methods. B. Animals must be able to get rid of excess heat when temperatures increase. C. Animals must be able to conserve heat when temperatures drop. D. Animals must find a source of heat.

1. Which macromolecules were present in the unknown solution? In the milk?

Answers


These macromolecules could either be amino acids, proteins or nucleic acids. They are responsible for the chemical changes and reactions that affects largely the cell and its composition. Take for instance the cytoplasm of the cell where these organelles are settled. These simple organelles are composed of macromolecules which ignites and catalyses different functions that enables cells, in macro-perspective in motion and metabolism. In intestines for example, metabolism happens and breaking down parts of a food to simpler compounds that are used and these nutrients delivered throughout the body and again broken down by into smaller components.

What are the parts or process that can describe an ecosystem?a. chemical changes and flow of energy
b. chemical changes and flow of water
c. physical changes and flow of energy
d. physical changes and flow of water

Answers

Answer:

a. chemical changes and flow of energy

Explanation:

Energy flow from one organisms of one tropic level to other, matter cycling and transformation of energy are the functions that sustain the ecosystem. Transformation of solar energy into chemical energy by plants serves as energy source for all heterotrophic living beings in the system. The heterotrophic organisms digest the ingested food (chemical change) to release energy to support their life processes. The energy stored at one tropic level is carried to next tropic level via food chain and food webs and represents the interaction between living components of ecosystem.

it is      A  both chemical changes and flow of energy

Scientists group organisms into kingdoms by looking at specific characteristics. Which is a characteristic of a carrot plant? no cell walls heterotrophic unicellular eukaryotic

Answers

Scientists group organisms into kingdoms by looking at specific characteristics. The characteristic of the carrot plant is eukaryotic. Organisms with eukaryotic cells are whose cells contain a nucleus and other organelles enclosed within membranes.

Explanation:

Eukaryotes are organisms whose cells have a nucleus surrounded by membranes, unlike prokaryotes. Eukaryotic cells are larger than prokaryotic cells and have a “true” nucleus, membrane-bound organelles, and rod-shaped chromosomes. The nucleus houses the cell's DNA and regulates the structure of proteins and ribosomes.

The carrot plant is characterized to be a eukaryotic organism belonging to the Kingdom Plantae.

What are eukaryotic organisms?

Eukaryotic organisms are organisms that have cell nuclei and membrane-bound organelles, which are classified into four different kingdoms (Protista, Animalia, Plantae and Fungi).

  • Eukaryotic organisms are composed of one (unicellular) or more cells (multicellular organisms).

  • Plants are eukaryotic multicellular organisms belonging to the kingdom Plantae.

In conclusion, the carrot plant is characterized to be a eukaryotic organism belonging to the Kingdom Plantae.

Learn more about eukaryotes here:

brainly.com/question/13969093

The value of money for buying goods and services is known as A) inflation. B) nomination. C) nominal income. D) purchasing power.

Answers

Answer: d: purchasing power (:

Explanation:

Female gametangia are called archegoniaantheridia while male gametangia are called antheridiaarchegonia .

Answers

The correct answer to the question above is archegonia and antheridia. Female gametangia are called ARCHEGONIA (a multicellular structure of the gametophyte) while the male gametangia are called ANTHERIDIA (a haploid structure that is containing the male gametes.) 

A plant cell cannot produce enough energy which organelle is not to blame

Answers

Answer:

mitochondria

Mitochondria is the cell responsible for producing energy in the plant cell