Red blood cells float in blood plasma. What kind of mixture is blood?

Answers

Answer 1

Answer:

the answer is suspension

Related Questions

Which elevation zone on the image above is best suited for growing bananas and sugarcane?a. Tierra Fria b. Tierra Templada c. Tierra Caliente d. Tierra Helada
What structure makes the windpipe stay open,but able to bend
Write three observations that could help you identify a fish.
How are the frog nostrils different from human nostrils
1) Periosteum is soft connective tissue.True False 2) Periosteum is soft connective tissue. True False

Most animal cell membranes have proteins that pump ______ ions out of the cell and potassium ions into the cell.

Answers

Most animal cell membranes have proteins that pump Sodium ions out of the cell and potassium ions into the cell .

I hope that's help !

Which best describes the process of radiation? A. Warm air transfers heat energy to cold air. B. Sunlight transfers energy to land, air, or water. C. Cold air transfers heat energy to warm air. D. Reflections from the surface warm the atmosphere.

Answers

The correct answer is option D

Reflections from the surface warm the atmosphere.

Reason -Radiation is the process by which the earth radiates the heat absorbed by it during the day time. The earth absorbs the solar radiation during the day time and gets heated , during evening the earth emits the heat in the form of reflections i.e radiation due to which the hearth gets further heated up.

I believe the answer is C. Cold air transfers heat energy to warm air. I don't know how great I can describe the answer but there you go

How do conservation tillage practices lead to agricultural sustainability?

Answers

The conservation of tillage practices leads to agricultural sustainability by protecting the farmer's crops from insects and other pests, thus, it reduces the need for the farmers to buy pesticides for the crops, since the tillage method prevents insects.

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

Answers

Thats a long one, but I got you!

A change in the DNA sequence, such as the mutation you described from 3' GTTACAGCACAGGGTAAACTC 5' to 3' GTTACAGCACAGGGTAAACGC 5', can have a significant impact on the protein produced. This specific type of mutation is called a "point mutation" or "single-nucleotide mutation" because it involves the substitution of a single nucleotide (in this case, a C for a T).

The impact on the protein depends on the role of the altered DNA sequence in encoding the protein. Here are the possible outcomes:

1. **Silent Mutation:** If the mutation does not change the amino acid encoded by the affected codon (a triplet of three nucleotides), it's considered a silent mutation. In this case, the protein's structure and function remain unchanged, as the altered DNA sequence still codes for the same amino acid.

2. **Missense Mutation:** If the mutation changes the codon to one that encodes a different amino acid, it's called a missense mutation. This can lead to an altered protein with potentially different properties or functions, depending on the nature of the new amino acid.

3. **Nonsense Mutation:** If the mutation changes a codon to a stop codon (a codon that signals the end of protein synthesis), it leads to a truncated protein. The protein will be shorter than the original, possibly lacking critical functional domains.

4. **Frameshift Mutation:** In cases where insertions or deletions of nucleotides occur (shifting the reading frame), it can result in a frameshift mutation. This often leads to a nonfunctional or drastically altered protein.

To determine the specific impact of the mutation, you would need to translate the altered DNA sequence into its corresponding amino acid sequence and assess how the change affects the protein's function, structure, and properties. The type of mutation and its consequences can vary, and it's essential to consider the specific genetic code and the context within the protein-coding region.

Which sequence below would result in the production of a protein?A: DNA → ribosome → mRNA

B: ribosome → DNA → mRNA

C: DNA → mRNA → ribosome

D: ribosome → mRNA → DNA

Answers

C is the most suitable answer

The answer is A because DNA starts it then ribsome produces it and then mRNA releases it

Where in the Venn diagram would you place the term haploid?

Answers

A Venn Diagram is used to show the differences and the similarities of two things. "Haploid" is most commonly compared to "Diploid" cells. Therefore, in a venn diagram, the term 'haploid' would be placed under or above one side of the circle, indicating that the texts within the circle are properties or descriptions of 'Haploid'.

C Meiosis produces gametes or sex cells with half the chromosome number. Half the chromosome number is the haploid number or N.

Other Questions

Which of the following defines evolution? a change in environmental conditions a change in an animal's physical traits a change in a population's gene pool a change in an individual's genetic makeup

The difference between protostomes and deuterostomes is _____. protostomes have only an ectoderm and endoderm protostomes have only a mesoderm protostomes develop a mouth first and then an anus protostomes develop an anus first and then a mouth

It is a good idea at an interview to _____.

Jordan exercises one to two times a week. She usually works out alone. Between meals, she sometimes snacks on potato chips from the bag. Which suggestion would least improve Jordan's overall fitness?