Which statement describes a limitation of the kinetic-molecular theory for a gas?a. The theory assumes that particles do not experience intermolecular forces.
b. The theory states that pressure is inversely proportional to volume.
c. The theory assumes that particles are in random and continuous motion.
d. The theory states that pressure increases with temperature.

Answers

Answer 1

Answer: I think the correct answer from the choices listed above is option A. A limitation of the kinetic-molecular theory for a gas is the theory assumes that particles do not experience intermolecular forces.This cannot be completely true since interactions between particles is normal.

Answer 2

Answer:

Answer:

Explanation:

Related Questions

Which statement accurately describes the relationship between cytokinesis and mitosis? a. Mitosis includes interphase and cytokinesis. b. Cytokinesis precedes mitosis. c. Cytokinesis follows mitosis. d. Cytokinesis includes interphase and mitosis.
What determines the charge of an atom?
Where do most producers get their energy from?a. from the water b. from the sun c. from other organisms d. from the air
How does the length of the small intestine assist digestion?
What are the small finger like projections on neurons called?

Explain why something with only one cell can be considered to be an organism.

Answers

Regardless of being unicellular or multicellular, any individual form of life capable of growing, metabolizing nutrients, and usually reproducing is an organism.

In which body of water with mangroves most likely be found

Answers

Mangroves are most likely to be found in brackish water. Brackish water is more saltier than freshwater but it doesn't quite reach the level of seawater. Fun fact mangroves are called halophytes.

In order to decrease the genetic diversity of a population, you would need toadd individuals to a population
only let individuals breed with other individuals that have very different characteristics
increase a population's territory
remove individuals from a population

Answers

remove individuals from a population

1. Scientific theory
What is the definition of this answer ?

Answers

Answer:

scientific theory: an explanation of an aspect of the natural world that can be repeatedly tested and proved to be a success every time.

Julia is trying to place a duckbilled platypus, lizard, bear, and monkey on a phylogenetic tree. She learns that the duckbilled playpus, bear, and monkey are classified as mammals. She also learns that mammals share a common ancestor with reptiles. Which additional piece of information will be most helpful to Julia to properly build her phylogenetic tree?A. The platypus has fur like other mammals
B. The platypus lays eggs like a reptile.
C. The platypus does not have fins like a fish.

Answers

The additional information required is that the platypus lays eggs like a reptile.

What are mammals?

The animals classified as mammals are those animals that give birth to their young ones alive and also possess the mammary gland. As such, they can breast feed their young ones.

Since the mammals share a similar ancestry as the reptiles, the additional information that Julia requires is that the platypus lays eggs like a reptile.

Learn more about reptiles: brainly.com/question/16357973?

The platypus lays eggs like a reptile is an additional piece of information will be most helpful to Julia to properly build her phylogenetic tree.

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

Answers

Thats a long one, but I got you!

A change in the DNA sequence, such as the mutation you described from 3' GTTACAGCACAGGGTAAACTC 5' to 3' GTTACAGCACAGGGTAAACGC 5', can have a significant impact on the protein produced. This specific type of mutation is called a "point mutation" or "single-nucleotide mutation" because it involves the substitution of a single nucleotide (in this case, a C for a T).

The impact on the protein depends on the role of the altered DNA sequence in encoding the protein. Here are the possible outcomes:

1. **Silent Mutation:** If the mutation does not change the amino acid encoded by the affected codon (a triplet of three nucleotides), it's considered a silent mutation. In this case, the protein's structure and function remain unchanged, as the altered DNA sequence still codes for the same amino acid.

2. **Missense Mutation:** If the mutation changes the codon to one that encodes a different amino acid, it's called a missense mutation. This can lead to an altered protein with potentially different properties or functions, depending on the nature of the new amino acid.

3. **Nonsense Mutation:** If the mutation changes a codon to a stop codon (a codon that signals the end of protein synthesis), it leads to a truncated protein. The protein will be shorter than the original, possibly lacking critical functional domains.

4. **Frameshift Mutation:** In cases where insertions or deletions of nucleotides occur (shifting the reading frame), it can result in a frameshift mutation. This often leads to a nonfunctional or drastically altered protein.

To determine the specific impact of the mutation, you would need to translate the altered DNA sequence into its corresponding amino acid sequence and assess how the change affects the protein's function, structure, and properties. The type of mutation and its consequences can vary, and it's essential to consider the specific genetic code and the context within the protein-coding region.

Other Questions

Glucose is NOT made from which of the following? carbon dioxide sodium chloride light water

Limiting contact between gamma rays and healthy tissue is important because?

Muscle cells would contain a high number ofA. lysosomes.B. mitochondria.C. mRNA.D. Golgi bodies.

Many inherited disorders of humans appear in children of parents who do not have the disorder. How can you explain this?