BIOLOGY COLLEGE

Scientist can determine the age of ancient objects by a method called radiocarbon dating. The bombardment of the upper atmosphere by cosmic rays converts nitrogen to a radioactive isotope of carbon, 14C, with a half-life of about 5730 years. Vegetation absorbs carbon dioxide through the atmosphere and animal life assimilates 14C through food chains. When a plant or animal dies, it stops replacing its carbon and the amount of 14C begins to decrease through radioactive decay. Therefore, the level of radioactivity must also decay exponentially. A parchment fragment was discovered that had about 64% as much 14C radioactivity as does plant material on Earth today. Estimate the age of the parchment. (Round your answer to the nearest hundred years.) yr

Answers

Answer 1

Answer:

Answer:

$3688.323$ years

Explanation:

Given-

Half life of $14$ C $= 5730$ years

As we know -

$A_((t)) = A_0e^(kt)$

Where

$A_((t)) =$ Mass of radioactive carbon after a time period "t"

$A_0=$ initial mass of radioactive carbon

$k =$ radioactive decay constant

$t =$ time

First we will find the value of "k"

$(1)/(2) = (1)*e^(k*5730)\n$

On solving, we get -

$e^(5730*k)= 0.5\n5730*k = ln(0.5)\nk = -0.000121$

Now, when mass of 14C becomes $64$ % of the plant material on earth today, then its age would be

$A_((t)) = A_0*e^((-0.000121*t))\nA_((t))= 0.64*A_0\n0.64*A_0 = A_0*e-^((0.000121*t))\nt = 3688.323$ years

Related Questions

Which of the following statements about tRNA is FALSE? A. tRNAs of both eukaryotes and prokaryotes share common features. B. The two-dimensional structure of tRNAs exhibits a cloverleaf pattern. C. tRNAs are produced in the nucleus. D. functional tRNAs have been spliced by splicesomes. E. tRNAs possess an anticodon complementary to the codon.
Name three different cells in a leaf that contain chloroplast. Please help
Research Problem: You come across three new species of primates that all cohabitate the same forested area. No one has looked at the behavior of these monkeys before so there is lot to discover about each species. You and a fellow researcher are interested in describing the diet of each of these species (Do they eat fruits? Leaves? Insects? Tree-sap? A combination of sorts?). Your fellow researcher has determined that her hypothesis is that two of the monkeys primarily eat fruit, while one of the monkey species eats tree sap.
Which division has a single preganglionic neurons with many axon collaterals that forms 20 or more synapses with postganglionic neurons?a. sympathetic motor division b. parasympathetic motor division c. sympathetic sensory division d. parasympathetic sensory division
A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes the codon GAA, and is charged with the amino acid Glutamic acid. The mutant tRNA is still charged with Glu, but the anticodon is mutated such that it recognizes the codon UAA. What effect will this have on translation in these cells

Which of the following statements can be attributed to water's versatility as a solvent

Answers

Answer:

The polar nature of water make water universal solvent.

Explanation:

The polar nature of water is responsible for the versatility as a solvent because due to this polar nature of water maximum number of solutes or chemicals dissolved in it and it is also called universal solvent. Polar nature means making positive and negative polar which attracts the opposite charge atoms and making covalent bond with them. The hydrogen has partial positive charge so it attracts negative charge atom while oxygen has partial negative charge so it attracts positive charge atom.

Water's versatility as a solvent can be attributed to its polarity, hydrogen bonding, and high dielectric constant.

Water's versatility as a solvent can be attributed to several factors:

Polarity:

Water is a polar molecule, meaning it has a slightly positive end and a slightly negative end. This allows water to dissolve many different substances that have charged or polar molecules, like salts and sugars.

Hydrogen Bonding:

Water can form hydrogen bonds with other molecules. This allows it to dissolve substances that can form hydrogen bonds with water, such as alcohols and organic acids.

High Dielectric Constant:

The dielectric constant of water is relatively high, which means it can weaken intermolecular forces between solute particles and allow them to dissolve more easily.

For more such questions on Water's versatility, click on:

brainly.com/question/32911730

#SPJ6

Which three of these development were major effector european colonization in africa

Answers

Answer:

improvement in transportation and education systems. disregard for existing political or ethnic boundaries. promotion of free trade across countries.

Explanation:

Answer:

More advanced medicine

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode and sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion

Answers

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

Kane how is co-evolution of symbiotic prokaryotes with eukaryotes similar and different to co-evolution in parasite-host systems?

Answers

How co-evolution of symbiotic prokaryotes with eukaryotes similar and different to co-evolution in parasite-host systems is that co existing has provided a sense of advantage with in the environment. One example of this are the parasites. There are different kinds of symbiotic relationships and this shows how similar and different co-evolution is. Hope this helps.

What is the density of a liquid that has a volume of 20 ml and a mass of 3g

Answers

The density of a liquid that has a volume and mass is calculated first to understand the mass and density of the liquid.

If 500 mL of a liquid has a density of 1.11 g/mL,

what is its mass?

$m = d×V = 500 mL × 1.11g1mL = 555 g$

VOLUME $d = mV$

The density of a liquid may be a measure of how heavy it's for the quantity measured. If you weigh equal amounts or volumes of two different liquids, the liquid that weighs more is denser.

If a liquid that's less dense than water is gently added to the surface of the water, it'll float on the water.

The degree of loudness or the intensity of a sound also :

loudness
the amount of space occupied by a three-dimensional object as measured in cubic units (such as quarts or liters).

Therefore, The density of the liquid is 555g.

Learn more about the Density of mass here:

brainly.com/question/24650225

Answer:

: If 500 mL of a liquid has a density of 1.11 g/mL, what is its mass? m = d×V = 500 mL × 1.11g1mL = 555 g. VOLUME. d = mV. We can rearrange this to .

Explanation:

_____ is a condition in which a person has difficulty breathing while sleeping.

Answers

It is known as sleep apena

Other Questions

A researcher conducted crosses between two different strains of Drosophila. When true-breeding flies with singed bristles (s) and normal wings (L) were crossed to true-breeding flies with normal bristles (S) and vestigial wings (l), all F1 offspring had normal wings and normal bristles. The F1 offspring were crossed to flies with singed bristles and vestigial wings. Which F2 offspring is/are recombinant?

It can be inferred that a person who has lost sight in one eye, will come to predominantly use which of the following type of information to perceive depth?I. Binocular visionII. The clarity of objectsIII. Retinal disparities

Which is the answer for it? I will appreciate the help

Consider this plant cell.Which organelle is labeled A? nucleus vacuole ribosome mitochondrion