The Redwood trees in Oregon are huge. They increase their size and weight by___ A. binary fission B. multiple fission C. mitosis or D. meiosis

Answers

Answer 1

Answer:

Answer:

(C). mitosis.

Explanation:

In multicellular organisms, mitosis is responsible for the growth, repair, and enlargement of organism, by producing more number of new identical cells. Mitosis is a type of cell division that involves formation of two similar daughter cells from a parent cell.

The Redwood tree is an eukaryotic, multicellular plant, in which growth and development occurs by the mitosis. Hence, the process that would increase the weight and size of Redwood trees is mitosis.

Thus, the correct answer is option (C).

Answer 2

Answer: D. is most likely the answer

Related Questions

High maternal stress during pregnancy has been linked with a higher risk of having a child with
Most moths of a particular population died when the chestnut blight fungus that they were dependent on got wiped out. But some moths did survive. Which mechanism explains the reason for this?
Give 2 ways the barn owl is suited for catching small animals
How many calories of energy will 20 grams of carbohydrates provide if 1 gram provides 4 calories?A. 80 caloriesB. 100 caloriesC. 200 caloriesD. 240 calories
When DNA is copied, sometimes a new, incorrect, base pairing appears within the structure of a new DNA molecule replacing original base pairs. This mistake is called a base-paira. deletion b. institution c. Substitution

All taxonomic systems of classification use five kingdoms.

True
False

Answers

the answer for this is false

Henry was told that a new plant fertilizer, Bigger Fruits & Veggies, was the best thing on the market. Advertisements even claimed that his plants would grow 50% larger if he used this product.

Answers

Answer:

No fertilizer at all

Plant growth

Bigger Fruits & Veggies and Growing Green

Explanation:

What is the likely origin of chloroplasts

Answers

Chloroplast is once a single cell organism, a prokaryotic cell that will engulf in a eukaryotic cell. This eukaryotic cell containts a mitochondria that is developed inside a eukaryotic cell. After the two cell engulf, photosynthesis takes place which makes the prokaryotic cell evolves into a chloroplast organelles.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

What part of a wind turbine provides motion to convert into electricity?a. generator
b. blades
c. tower
d. rotor

Answers

There are twotypes of modern wind turbines. In a Verical-axis wind turbines (VAWTs), theshaft is mounted on a vertical axis perpendicular to the ground. They arealigned with the wind so there’s no adjustment necessary when the winddirection changes. It can’t start moving on itself that is why it needs a boostfrom its electrical system to get started. It uses wires for support so therotor elevation is lower. They are less efficient than HAWTs due to its lowerelevation. Lower elevation means slower wind due to ground interferences. Theother type is Horizontal-axis wind turbines (HAWTs), the shaft s mountedhorizontally parallel to the ground. It is constantly aligned with the windusing a yaw-adjustment mechanism. This mechanism moves the entire rotor left orright in small increments. It uses a tower to lift the turbine components to anoptimum elevation for wind speed and take up very little ground space. It ismuch more efficient than VAWT. The motion that converts into electricity is therotor. The answer is letter D.

The answer is B. blades, I just took the test.

Which of the following explains how natural selection leads to evolution? A. Conditions in the environment reduce competition for resources within a species. B. Helpful variations accumulate among surviving members of the species. C. Overproduction provides food for stronger members of the species. D. Environmental changes favor weaker members of the species.

Answers

B.

......'.................

Environmental changes favor weaker members of the species.

Other Questions

What is the process that allows DNA to make copies of itself before cell division? Where in the cell does this take place?

The gametophyte is much larger than the sporophyte in all of the following excepta. mosses. b. liverworts. c. pine trees. d. horsetails.

Select all that apply.The most abundant elements in living organisms are _____.fluorinehydrogencarbonoxygennitrogen

As with waterborne pathogens, foodborne pathogens are mostlikely to produce gastrointestinal symptoms. * TRUE or FALSE ?