How have humans offset the balance of the carbon cycle(EXPLAIN HOW YOU GOT THAT LETTER CHOICE)
A. Cutting trees which increase the amount of carbon available for food/
B. Cutting trees which will increase carbon dioxide in the atmosphere.
C. Cutting trees which reduces available oxygen for humans.
D. Cutting trees which will reduce water in the atmosphere.

Answers

Answer 1

Answer: The correct answer is C. Trees provide oxygen for humans, so by reducing trees you reduce oxygen available for humans.

Related Questions

Cell bodies of sensory neurons may be located in ganglia lying outside the central nervous system. Cell bodies of sensory neurons may be located in ganglia lying outside the central nervous system. True False
The clown fish is able to make its home in the poisonous sea anemone, but any other fish that comes along would be paralyzed and killed. The clown fish also seems to keep butterfly fish away from the anemone, as they eat its tentacles.Which term describes the relationship between the sea anemone and the clown fish? a. parasitism b. mutualism c. commensalism d. competition
The compound sodium chloride is formed by which kind of bond?
Why have improvements in microscopes over time resulted in revisions in the cell theory? They have revealed new information about cell structure and processes. They have made microscopes easier to use. They have allowed scientists to share pictures of the cells being studied. They have made it possible to confirm what scientists already suspected.
In which form do plants store energy?a. starchb. glycogenc. chitind. cellulose

How did the CCC help Watson improve his life?

Answers

There were millions of people helped by the CCC. The CCC is also known as Civilian Conservation Corps. Stanley Watson's life was improved because he got a job and enrolled in college. He finished college with a good degree and got a great job.

The type of insects and the stage of the insect's life can give some indication on how long a body has been dead. True False

Answers

In general, no, it is false that the type of insects and the stage of the insect's life can give some indication on how long a body has been dead.

Answer: True

Explanation:

Forensic entomology is a sub-discipline of forensic science. It deals with the study of insects and their life cycles which are found in close proximity of the dead body. The type of insects grow over the body depends upon the stage of decomposition of the body. Also the life cycle varies depending upon the feeding nature of the immature stages of the developing insect on the dead body. More deformed body by the insects as evident by the colonization of eggs, and other immature stages as well as the mature insects can give indication of the time since death.

On the basis of the above description, the given statement is true .

Why are viruses not able to make their own proteins?

Answers

Viruses don't make their own proteins because they are not cells. A virus is a nucleic acid enclosed in a protein coat, and does not contain organelles. Bacteriophages, viruses that target bacteria as a host, inject their genetic material into the host bacterial cell. Therefore, cells don't even need proteins, (not including their protein coat) so they do not make them.

*Keep in mind that since there are no organelles, there are no ribosomes for the RNA (ribonucleic-acid) to deliver the coded message and amino acids to.

Answer:

Because viruses do not have their own cellular mechinary. They lack enzymes for replication of DNA and to produce their protein.

Explanation:

In an experiment you, the researcher, remove atp from the system. what would be a likely consequence of the lack of atp on muscle contraction?

Answers

The tropomyosin filament would not be dislodged preventing contraction.

The cross bridges would remain linked and therefore contraction would stop

The cross bridges would break apart due to the presence of calcium ions enabling some contraction

The myosin heads would separate from the actin molecule due to the release of ADP that was previously present.

1.ATP hydrolysis

2.Detachment of myosin head from actin

3.Power stroke

4.Crossbridge formation

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

What is the most appropriate unit for describing a 26-mile marathon run?A.terameter
B. gigameter
C.kilometer
D. nanometer

Answers

The most appropriate unit for describing a 26 mile marathon run would be C. Kilometre. As kilometres can be easily utilized and converted to miles and vice-versa.

Answer:

c) kilometer

Explanation:

took the edg 2020 test :)

Other Questions

Protozoans that are parasites never have more than one host? true or false

What two taxonomic domains are divided based on the presence, or absence, of peptidoglycan?

Plants and animals cells make exact copies through the process of

A single strand of DNA contains the following nine nucleotides in this order: ACT TAT GGA. What sequence of bases will be present on the complementary strand of DNA?