Skin cancer is to exposure to uv radiation as

Answers

Answer 1
Answer: Acne is to excessive secretion of oil

Related Questions

___________ can be used by cells to store energy, form biological membranes, and serve as chemical messengers.
Often, the second part of a scientific name is _________. a description of a trait or habitat the same as for other members of the same genus capitalized if it derives from a proper name different in different locations
What is syntax?A. the use of rambling, private thoughtsB. the arrangement of words in a sentenceC. the point of view from which a story is narratedD. language that is not intended to be taken literally
Scientists group organisms into kingdoms by looking at specific characteristics. Which is a characteristic of a carrot plant? no cell walls heterotrophic unicellular eukaryotic
Organisms that have genes from another species spliced into them are called ______________________. A- enucleated B- vectors C- gene knocks D- transgenic

A come,a seats 250 people. If 170 people are in the cinema, what percentage of the seats are filled?

Answers

Given that there are 250 seats in the cinema and they are 170 people sitting on the seats provided, in order to get the percentage we will first arrange the given details.

250 seats

170 seats filled

X = percentage

Take 170 / 250

So it will be 170 ● 100 = 17,000

Next, 17,000  250 = 68

So we will have 170 is the 68% of 250. Therefore, 68% of the seats in cinema are filled.

What would happen if photosynthesis stopped happening on earth?a; there would be more oxygen in the air
b ; sun would produce less energy
c ; carbon dioxide levels would increase
d; Biodiversity would increase in rain forest

Answers

The correct answer is option C

Photosynthesis is the process by which green plants make their own food by the help of carbon dioxide, sunlight and chlorophyll. The green plants produce oxygen in the air and utilize the carbon dioxide present there. If there will be no photosynthesis on the earth then there will be increased amount of carbon dioxide on earth.

C. carbon dioxide levels will increase

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

What causes chemical weathering?a.
damage caused by animals and plants
c.
natural acids
b.
ice wedging
d.
physical factors

Answers

natural acids because chemicals erode rocks in chemical weathering

OK so basically Chemical weathering occurs from rain and other things that are washed in with it so best choice will be to go with option C. Natural Acids.

which of the following shows the correct order in which genes are expressed? a. DNA to rna to proteins. b. rna to DNA to proteins. c. rna to proteins to DNA. d. DNA to proteins

Answers

Answer:

a. DNA to RNA to proteins.

Explanation:

DNA is the genetic material which is transcribed into RNA in nucleus. The mRNA leaves nucleus and joins ribosomes for the process of protein synthesis. The nucleotide sequence of mRNA serves as template for protein synthesis. Hence gene expression occurs in following direction:

DNA------> RNA--------> Protein

This unidirectional flow of genetic information is also called as central dogma.

Final answer:

The correct order in which genes are expressed is DNA to RNA to proteins.

Explanation:

The correct order in which genes are expressed is a. DNA to RNA to proteins.

During the process of gene expression, the DNA sequence is first transcribed into RNA through a process called transcription. The RNA molecule then serves as a template for protein synthesis, a process called translation, where amino acids are assembled into a polypeptide chain, forming proteins.

Learn more about Gene Expression here:

brainly.com/question/33276216

#SPJ6

If one parent is heterozygous white (Ww) and the other is homozygous black (ww), give the phenotype and genotype ratios for this cross.

Answers

So if you cross a heterozygous white and a homozygous black, draw a punnet square. So the box is a 2 by 2 with Ww on the top two and ww on the side to. So in the top left corner, it would be Ww, top right, ww, bottom left, Ww, and bottom right, ww. So the possible phenotypes is half and half Ww and ww. This means that two of the potential phenotypes are Ww and ww, both occurring 50% of the time