BIOLOGY HIGH SCHOOL

The major cause of ozone depletion is?

Answers

Answer 1
Answer: CFCs are the major cause of ozone depletion in our surroundings. These are capable of using ODS which was responsible for the 80% of destruction in the ozone layer nowadays. It's often found in coolants like refrigerators and air conditioners. It's also used when making foam products and hospital sterilizers.
Answer 2
Answer: I believe the major cause are greenhouse gases, CFC's are a greenhouse gas. Over time these gases damage the Ozone layer and tear it apart , resulting in the entrance of more UV rays into Earth's atmosphere, which melt ice caps causes floods and drowning the Earth after a certain amount of time.

Hope this helps, plz put me brainliest^-^

Related Questions

Gene maps are based on
A snake that eats a mouse is an exampe of
Which term describes the chromosomal abnormality of having extra chromosomes?
Which molecules do cells need to release energy? (Can you make it look like 7th grade writing please well if you can)
Why do deciduous trees lose their leaves?a. Deciduous trees lose their leaves to prevent oxygen loss. b. Deciduous trees lose their leaves to defend from predators. c. Deciduous trees lose their leaves to prevent nutrient and water loss. d. Deciduous trees die in winter.

Explain why the following statements are incorrect - As long as an organism survives, natural selection will take place

Answers

First off, natural selection occurs when animals survive and adapt to their environment long enough to create offspring.So as long an organism adapts and survives, natural selection will take place.

Which is the term applied to the repeating stages that a cell experiences, including cell division?. . A.. Mitosis. . B.. Meiosis. . C.. S phase. . D.. Cell cycle.

Answers

I believe that the answer should be D. Cell cycle.

Which of the following is considered by most biologists to be the most accurate in supporting the theory of evolution?A. Fossils
B. Embryology
C. DNA sequencing
D. Genetic equilibrium

Answers

d is the answer i believe

How are the benefits of wildfires in grasslands and northern forests similar?a. increased tree quantityb. increased food production for grazersc. increased amount of lichensd. all of the abovePlease select the best answer from the choices provided

Answers

The benefits of wildfires in grasslands and northern forests are similar - b. increased food production for grazers

Wildfires affect the ecosystem by

  1. remove low-growing underbrush,
  2. clean the forest floor of debris,
  3. open it up to sunlight,
  4. nourish the soil.
  • The grassland and northern forests ecosystem are maintained by wildfire.
  • It warms up the soil and reduces leaf litter.
  • It allows sunlight to penetrate and grow more food production for grazers

Learn more

brainly.com/question/10471391
Are you referring to this question?
How are the benefits of wildfires in grasslands and northern forests similar?
a. increased tree quantity 
b. increased food production for grazers
c.increased amount of lichensd. all of the above

If you are, the answer would be letter B. 
Wildfires not only do they remove dead and decaying plants that act as fuel for future fires — ones that will be more intense and disastrous, wildfires  work to eliminate dense foliage and thin out the forest allowing plants closer to the forest floor to come in more contact with sunlight and rain, “enabling a new generation of seedlings to grow” 

>>>forest fires play a vital role in maintaining nature’s constant cycle.

Which of these buildings is most likely to have indoor air pollution

Answers

The building from the list provided with the highest likelihood of air pollution is a tightly sealed house with an unvented water heater. The school with leaks will let air exchange happen so that isn't it, and having a carbon monoxide detector only reports existing air pollution it doesn't prevent air pollution, it could have issues but we don't know. The tightly sealed house with the unvented water heater is a near sure thing.

when heater is on for long time without having ventilation then carbondioxide will be converted into carbon monoxide and causes air pollution.

So according to above explanation,

C. A tightly sealed house with an unvented water heater, is the correct answer.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA
Other Questions
A Russian citizen has illegally obtained a Siberian tiger and is trying to sell the tiger’s fur in the United States. What treaty does this violate?
The science of grouping and naming organisms is called what.
The study of plants A. Anatomy B. Botany C. Physiology D. Psychology
What word describes a female human carrying an embryo